{"resourceType": "bloodgroup", "id": "ABO", "data": {"abbreviation": "ABO", "isbt_num": "001", "name": "ABO", "description": "The ABO system was discovered as in 1900 and is considered the first and clinically most important system. The ABO gene and its 7 coding exons give rise to one of two principally different glycosyltransferases. The A glycosyltransferase (GTA) catalyzes the addition of a donor substrate, UDP-N-acetylgalactosamine, to an acceptor substrate known as the H antigen. The B glycosyltransferase (GTB) differs by only four amino-acid substitutions from GTA and performs the same enzymatic reaction but uses UDP-galactose as donor substrate. In this way, genetic polymorphism gives rise to two related antigens in this system. Any polymorphism or mutation that changes the activity or specificity of the encoded enzyme may therefore alter the ABO phenotype. Alterations that completely abolish enzymic activity give rise to the blood group O phenotype, in which the H antigen remains unconverted and no A or B antigen can be detected. If the genetic alteration decreases the activity of the enzyme, or alters its subcellular location and thereby decreases conversion of H to A or B, a weak A or B subgroup phenotype can result. Furthermore, certain polymorphisms result in promiscuous enzymes that can synthesize both A and B antigen, thereby resulting in the so-called cisAB or B(A) phenotypes. The A phenotype is divided into A1 and A2. The former is more prevalent in all populations and has approximately 5 times more A epitopes per red cell. The GTA1 is also better than GTA2 at synthesizing certain forms of A, .e.g. A type 3 and 4. \r\nIn addition to the A and B antigens, two other antigens are included in the ABO system, namely A,B and A1. The former is a joint epitope on A or B antigen and is therefore present in both A, B and AB phenotypes. The exact biochemical nature of the A1 antigen has been more controversial but has been proposed to represent A type 4.", "transcription_factor": false, "gene_list": [{"id": "ABO", "aa_sequence": "", "chromosome": "chr10", "comment": "", "description": "", "entrez_gene_id": 28, "forward": false, "hg_19_cds_start": 136131052, "hg_19_cds_end": 136150605, "hg_19_end": 136150630, "hg_19_start": 136130562, "hg_19_num_exons": 7, "hg_38_cds_start": 133255665, "hg_38_cds_end": 133275189, "hg_38_end": 133275201, "hg_38_start": 133250400, "hg_38_num_exons": 7, "hgnc_id": null, "symbol": "ABO", "name": "ABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase", "reference_genomic": "NG_006669.1", "reference_transcript": "NM_020469.2", "reference_protein": "NP_065202.2", "sequence": "GGAGGCCGAGACCAGACGCGGAGCCATGGCCGAGGTGTTGCGGACGCTGGCCGGAAAACCAAAATGCCACGCACTTCGACCTATGATCCTTTTCCTAATAATGCTTGTCTTGGTCTTGTTTGGTTACGGGGTCCTAAGCCCCAGAAGTCTAATGCCAGGAAGCCTGGAACGGGGGTTCTGCATGGCTGTTAGGGAACCTGACCATCTGCAGCGCGTCTCGTTGCCAAGGATGGTCTACCCCCAGCCAAAGGTGCTGACACCGTGTAGGAAGGATGTCCTCGTGGTGACCCCTTGGCTGGCTCCCATTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGGGTTAACTGTGTTTGCCATCAAGAAATACGTGGCTTTCCTGAAGCTGTTCCTGGAGACGGCGGAGAAGCACTTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCAGCCGGCCGCGGTGCCCCGCGTGACGCTGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGCGCGCCTACAAGCGCTGGCAGGACGTGTCCATGCGCCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTCAGCGAGGTGGATTACCTGGTGTGCGTGGACGTGGACATGGAGTTCCGCGACCACGTGGGCGTGGAGATCCTGACTCCGCTGTTCGGCACCCTGCACCCCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCCGGCCCCAGTCCCAGGCCTACATCCCCAAGGACGAGGGCGATTTCTACTACCTGGGGGGGTTCTTCGGGGGGTCGGTGCAAGAGGTGCAGCGGCTCACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGCATCGAGGCCGTGTGGCACGACGAGAGCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCAAGGTGCTCTCCCCCGAGTACTTGTGGGACCAGCAGCTGCTGGGCTGGCCCGCCGTCCTGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGAGCGGCTGCCAGGGGCTCTGGGAGGGCTGCCGGCAGCCCCGTCCCCCTCCCGCCCTTGGTTTTAGCAGAACGGGTAAACTCTGTTTCCTTTGTCCGTCCTGTTGTGAGTAACTGAAGCCTAGGCCCCGTCCCCACCTCAAATCACACACACCCCCTCCCCACCACAGAGACACCATTACATACACAGACACACACAGAAAGACACACACAGACACAAAATCACACACACACCCTCCCCGCCACAGAGACACCATTACATACACAGACACACACAGAAAGACACAGACACAAAATCACACACACACCCTCCCCGCCACAGAGACACACCATTACATACACAGACACGCAATCGCAGATACGCCCTTCCGGCCACAGAAACACACCATTACACACACATACACAGAAAGACACACACAGACACACAATCACACGCAGCCCCTCCCCGCCACAGAGACACACCATTACATACACAGACACACACAGAAAGACAC", "uniprot_id": "P16442"}], "allele_list": [{"id": 1000004, "bgid": 1000004, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.02", "reference": false, "nt_mutation_list": [{"id": 4, "category": "del", "hgvs_name": "1054C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131063, "hg_38_start": 133255676, "new": "A", "original": "G", "rs_number": 56390333}]}, {"id": 1000005, "bgid": 1000005, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.03", "reference": false, "nt_mutation_list": [{"id": 5, "category": "del", "hgvs_name": "1054C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131063, "hg_38_start": 133255676, "new": "C", "original": "G", "rs_number": 56390333}]}, {"id": 1000006, "bgid": 1000006, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.04", "reference": false, "nt_mutation_list": [{"id": 500, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 431, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 402, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 352, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 268, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 141, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000007, "bgid": 1000007, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.05", "reference": false, "nt_mutation_list": [{"id": 7, "category": "del", "hgvs_name": "1009A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131108, "hg_38_start": 133255721, "new": "C", "original": "T", "rs_number": 566015043}, {"id": 207, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000008, "bgid": 1000008, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.06", "reference": false, "nt_mutation_list": [{"id": 16, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}]}, {"id": 1000009, "bgid": 1000009, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.07", "reference": false, "nt_mutation_list": [{"id": 296, "category": "del", "hgvs_name": "539G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131578, "hg_38_start": 133256191, "new": "G", "original": "C", "rs_number": 781806838}]}, {"id": 1000010, "bgid": 1000010, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.08", "reference": false, "nt_mutation_list": [{"id": 297, "category": "del", "hgvs_name": "539G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131578, "hg_38_start": 133256191, "new": "G", "original": "C", "rs_number": 781806838}, {"id": 208, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000011, "bgid": 1000011, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.09", "reference": false, "nt_mutation_list": [{"id": 17, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 288, "category": "del", "hgvs_name": "527G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131590, "hg_38_start": 133256203, "new": "T", "original": "C", "rs_number": 56039827}, {"id": 209, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000012, "bgid": 1000012, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.10", "reference": false, "nt_mutation_list": [{"id": 210, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 139, "category": "del", "hgvs_name": "268T>C", "location": "Intron", "location_info": "6", "hg_19_start": 136132901, "hg_38_start": 133257514, "new": "G", "original": "A", "rs_number": 781914378}]}, {"id": 1000013, "bgid": 1000013, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.11", "reference": false, "nt_mutation_list": [{"id": 211, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 138, "category": "del", "hgvs_name": "266C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132903, "hg_38_start": 133257516, "new": "A", "original": "G", "rs_number": null}]}, {"id": 1000014, "bgid": 1000014, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.12", "reference": false, "nt_mutation_list": [{"id": 18, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 289, "category": "del", "hgvs_name": "527G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131590, "hg_38_start": 133256203, "new": "T", "original": "C", "rs_number": 56039827}, {"id": 76, "category": "del", "hgvs_name": "190G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259832, "new": "T", "original": "C", "rs_number": 56335272}]}, {"id": 1000015, "bgid": 1000015, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.13", "reference": false, "nt_mutation_list": [{"id": 424, "category": "del", "hgvs_name": "742C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131375, "hg_38_start": 133255988, "new": "A", "original": "G", "rs_number": 928305857}, {"id": 212, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000016, "bgid": 1000016, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.16", "reference": false, "nt_mutation_list": [{"id": 19, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 213, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 42, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 55, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}, {"id": 67, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000017, "bgid": 1000017, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.17", "reference": false, "nt_mutation_list": [{"id": 214, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 198, "category": "del", "hgvs_name": "407C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131710, "hg_38_start": 133256323, "new": "A", "original": "G", "rs_number": 55658842}]}, {"id": 1000018, "bgid": 1000018, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.18", "reference": false, "nt_mutation_list": [{"id": 421, "category": "del", "hgvs_name": "722G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131395, "hg_38_start": 133256008, "new": "T", "original": "C", "rs_number": 868656449}, {"id": 215, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000019, "bgid": 1000019, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.19", "reference": false, "nt_mutation_list": [{"id": 456, "category": "del", "hgvs_name": "778G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131339, "hg_38_start": 133255952, "new": "T", "original": "C", "rs_number": 782075362}, {"id": 216, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000020, "bgid": 1000020, "allelecategory": "A", "gene": "ABO", "name": "ABO*A2.20", "reference": false, "nt_mutation_list": [{"id": 501, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 217, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000021, "bgid": 1000021, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.01", "reference": false, "nt_mutation_list": [{"id": 537, "category": "del", "hgvs_name": "871G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131246, "hg_38_start": 133255859, "new": "T", "original": "C", "rs_number": 781789696}]}, {"id": 1000022, "bgid": 1000022, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.02", "reference": false, "nt_mutation_list": [{"id": 20, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 502, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}]}, {"id": 1000023, "bgid": 1000023, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.03", "reference": false, "nt_mutation_list": [{"id": 532, "category": "del", "hgvs_name": "838C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131279, "hg_38_start": 133255892, "new": "A", "original": "G", "rs_number": null}]}, {"id": 1000024, "bgid": 1000024, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.04", "reference": false, "nt_mutation_list": [{"id": 21, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 294, "category": "del", "hgvs_name": "539G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131578, "hg_38_start": 133256191, "new": "T", "original": "C", "rs_number": 781806838}, {"id": 218, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000025, "bgid": 1000025, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.05", "reference": false, "nt_mutation_list": [{"id": 498, "category": "del", "hgvs_name": "820G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131297, "hg_38_start": 133255910, "new": "T", "original": "C", "rs_number": null}]}, {"id": 1000026, "bgid": 1000026, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.06", "reference": false, "nt_mutation_list": [{"id": 499, "category": "del", "hgvs_name": "820G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131297, "hg_38_start": 133255910, "new": "T", "original": "C", "rs_number": null}, {"id": 219, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000027, "bgid": 1000027, "allelecategory": "A", "gene": "ABO", "name": "ABO*A3.07", "reference": false, "nt_mutation_list": [{"id": 427, "category": "del", "hgvs_name": "745C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131372, "hg_38_start": 133255985, "new": "A", "original": "G", "rs_number": 781881648}, {"id": 220, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000028, "bgid": 1000028, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.01", "reference": false, "nt_mutation_list": [{"id": 495, "category": "delins", "hgvs_name": "804dupG", "location": "Intron", "location_info": "7", "hg_19_start": 136131313, "hg_38_start": 133255926, "new": "AC", "original": "A", "rs_number": null}]}, {"id": 1000029, "bgid": 1000029, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.02", "reference": false, "nt_mutation_list": [{"id": 370, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 323, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 221, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000030, "bgid": 1000030, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.03", "reference": false, "nt_mutation_list": [{"id": 494, "category": "ins", "hgvs_name": "804delG", "location": "Intron", "location_info": "7", "hg_19_start": 136131313, "hg_38_start": 133255926, "new": "A", "original": "AC", "rs_number": null}]}, {"id": 1000031, "bgid": 1000031, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.04", "reference": false, "nt_mutation_list": [{"id": 196, "category": "del", "hgvs_name": "374+5G>A", "location": "Promoter", "location_info": "6", "hg_19_start": 136131738, "hg_38_start": 133256351, "new": "T", "original": "C", "rs_number": 1289213676}]}, {"id": 1000032, "bgid": 1000032, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.05", "reference": false, "nt_mutation_list": [{"id": 429, "category": "del", "hgvs_name": "767T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131350, "hg_38_start": 133255963, "new": "G", "original": "A", "rs_number": null}, {"id": 222, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000033, "bgid": 1000033, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.06", "reference": false, "nt_mutation_list": [{"id": 223, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 201, "category": "del", "hgvs_name": "425T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131692, "hg_38_start": 133256305, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000034, "bgid": 1000034, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.07", "reference": false, "nt_mutation_list": [{"id": 503, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 432, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 371, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 224, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000035, "bgid": 1000035, "allelecategory": "A", "gene": "ABO", "name": "ABO*AEL.08", "reference": false, "nt_mutation_list": [{"id": 496, "category": "delins", "hgvs_name": "804dupG", "location": "Intron", "location_info": "7", "hg_19_start": 136131313, "hg_38_start": 133255926, "new": "AC", "original": "A", "rs_number": null}, {"id": 225, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000036, "bgid": 1000036, "allelecategory": "A", "gene": "ABO", "name": "ABO*AM.01", "reference": false, "nt_mutation_list": [{"id": 428, "category": "del", "hgvs_name": "761C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131356, "hg_38_start": 133255969, "new": "A", "original": "G", "rs_number": 1457148922}, {"id": 226, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000037, "bgid": 1000037, "allelecategory": "A", "gene": "ABO", "name": "ABO*AM.02", "reference": false, "nt_mutation_list": [{"id": 369, "category": "del", "hgvs_name": "664G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131453, "hg_38_start": 133256066, "new": "T", "original": "C", "rs_number": 782445625}]}, {"id": 1000038, "bgid": 1000038, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.01", "reference": false, "nt_mutation_list": [{"id": 22, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 227, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 199, "category": "del", "hgvs_name": "407C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131710, "hg_38_start": 133256323, "new": "A", "original": "G", "rs_number": 55658842}]}, {"id": 1000039, "bgid": 1000039, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.02", "reference": false, "nt_mutation_list": [{"id": 23, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 228, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 191, "category": "del", "hgvs_name": "350G>C", "location": "Intron", "location_info": "6", "hg_19_start": 136132819, "hg_38_start": 133257432, "new": "G", "original": "C", "rs_number": 782113784}]}, {"id": 1000040, "bgid": 1000040, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.03", "reference": false, "nt_mutation_list": [{"id": 24, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 229, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 80, "category": "del", "hgvs_name": "203G>C", "location": "Intron", "location_info": "4", "hg_19_start": 136135223, "hg_38_start": 133259819, "new": "G", "original": "C", "rs_number": 781831728}]}, {"id": 1000041, "bgid": 1000041, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.04", "reference": false, "nt_mutation_list": [{"id": 416, "category": "del", "hgvs_name": "721C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131396, "hg_38_start": 133256009, "new": "A", "original": "G", "rs_number": 781957267}]}, {"id": 1000042, "bgid": 1000042, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.05", "reference": false, "nt_mutation_list": [{"id": 561, "category": "del", "hgvs_name": "965A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131152, "hg_38_start": 133255765, "new": "C", "original": "T", "rs_number": 934089484}]}, {"id": 1000043, "bgid": 1000043, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.06", "reference": false, "nt_mutation_list": [{"id": 265, "category": "del", "hgvs_name": "502C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131615, "hg_38_start": 133256228, "new": "C", "original": "G", "rs_number": 573234689}]}, {"id": 1000044, "bgid": 1000044, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.07", "reference": false, "nt_mutation_list": [{"id": 25, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 314, "category": "del", "hgvs_name": "592C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131525, "hg_38_start": 133256138, "new": "A", "original": "G", "rs_number": 1211406855}, {"id": 230, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000045, "bgid": 1000045, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.08", "reference": false, "nt_mutation_list": [{"id": 474, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 269, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 260, "category": "del", "hgvs_name": "488C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131629, "hg_38_start": 133256242, "new": "A", "original": "G", "rs_number": 55756402}, {"id": 142, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 81, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000046, "bgid": 1000046, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.09", "reference": false, "nt_mutation_list": [{"id": 26, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 231, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 43, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 259, "category": "del", "hgvs_name": "46G>A", "location": "Intron", "location_info": "2", "hg_19_start": 136137554, "hg_38_start": 133262151, "new": "T", "original": "C", "rs_number": 55917063}, {"id": 82, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 56, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000047, "bgid": 1000047, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.10", "reference": false, "nt_mutation_list": [{"id": 457, "category": "del", "hgvs_name": "784G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131333, "hg_38_start": 133255946, "new": "T", "original": "C", "rs_number": 1403489417}]}, {"id": 1000048, "bgid": 1000048, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.11", "reference": false, "nt_mutation_list": [{"id": 417, "category": "del", "hgvs_name": "721C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131396, "hg_38_start": 133256009, "new": "A", "original": "G", "rs_number": 781957267}, {"id": 267, "category": "del", "hgvs_name": "523G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131594, "hg_38_start": 133256207, "new": "T", "original": "C", "rs_number": 555009598}]}, {"id": 1000049, "bgid": 1000049, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.12", "reference": false, "nt_mutation_list": [{"id": 308, "category": "del", "hgvs_name": "556A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131561, "hg_38_start": 133256174, "new": "C", "original": "T", "rs_number": 782121240}, {"id": 232, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000050, "bgid": 1000050, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.13", "reference": false, "nt_mutation_list": [{"id": 184, "category": "del", "hgvs_name": "2T>C", "location": "Intron", "location_info": "1", "hg_19_start": 136150604, "hg_38_start": 133275188, "new": "G", "original": "A", "rs_number": 782578311}]}, {"id": 1000051, "bgid": 1000051, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.14", "reference": false, "nt_mutation_list": [{"id": 399, "category": "del", "hgvs_name": "699C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131418, "hg_38_start": 133256031, "new": "T", "original": "G", "rs_number": 781796577}, {"id": 233, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000052, "bgid": 1000052, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.15", "reference": false, "nt_mutation_list": [{"id": 195, "category": "del", "hgvs_name": "374+4A>T", "location": "Promoter", "location_info": "6", "hg_19_start": 136131739, "hg_38_start": 133256352, "new": "A", "original": "T", "rs_number": 782069432}]}, {"id": 1000053, "bgid": 1000053, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.16", "reference": false, "nt_mutation_list": [{"id": 27, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 234, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 78, "category": "del", "hgvs_name": "1A>G", "location": "Intron", "location_info": "1", "hg_19_start": 136150605, "hg_38_start": 133275189, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000054, "bgid": 1000054, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.17", "reference": false, "nt_mutation_list": [{"id": 28, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 235, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 93, "category": "del", "hgvs_name": "236C>T", "location": "Intron", "location_info": "5", "hg_19_start": 136133490, "hg_38_start": 133258100, "new": "A", "original": "G", "rs_number": 782069936}]}, {"id": 1000055, "bgid": 1000055, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.18", "reference": false, "nt_mutation_list": [{"id": 29, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 236, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 190, "category": "del", "hgvs_name": "347T>C", "location": "Intron", "location_info": "6", "hg_19_start": 136132822, "hg_38_start": 133257435, "new": "G", "original": "A", "rs_number": 782433687}]}, {"id": 1000056, "bgid": 1000056, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.19", "reference": false, "nt_mutation_list": [{"id": 30, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 237, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 204, "category": "del", "hgvs_name": "434A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131683, "hg_38_start": 133256296, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000057, "bgid": 1000057, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.20", "reference": false, "nt_mutation_list": [{"id": 31, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 316, "category": "del", "hgvs_name": "607G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131510, "hg_38_start": 133256123, "new": "T", "original": "C", "rs_number": 374698850}, {"id": 238, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000058, "bgid": 1000058, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.21", "reference": false, "nt_mutation_list": [{"id": 32, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 318, "category": "del", "hgvs_name": "607G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131510, "hg_38_start": 133256123, "new": "G", "original": "C", "rs_number": 374698850}, {"id": 239, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000059, "bgid": 1000059, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.22", "reference": false, "nt_mutation_list": [{"id": 33, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 319, "category": "del", "hgvs_name": "634G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131483, "hg_38_start": 133256096, "new": "T", "original": "C", "rs_number": 376840879}, {"id": 240, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000060, "bgid": 1000060, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.23", "reference": false, "nt_mutation_list": [{"id": 34, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 422, "category": "del", "hgvs_name": "722G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131395, "hg_38_start": 133256008, "new": "T", "original": "C", "rs_number": 868656449}, {"id": 241, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000061, "bgid": 1000061, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.24", "reference": false, "nt_mutation_list": [{"id": 35, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 425, "category": "del", "hgvs_name": "742C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131375, "hg_38_start": 133255988, "new": "A", "original": "G", "rs_number": 928305857}, {"id": 242, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000062, "bgid": 1000062, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.25", "reference": false, "nt_mutation_list": [{"id": 36, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 504, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 243, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000063, "bgid": 1000063, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.26", "reference": false, "nt_mutation_list": [{"id": 37, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 290, "category": "del", "hgvs_name": "527G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131590, "hg_38_start": 133256203, "new": "T", "original": "C", "rs_number": 56039827}, {"id": 244, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000064, "bgid": 1000064, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.27", "reference": false, "nt_mutation_list": [{"id": 38, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 291, "category": "del", "hgvs_name": "527G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131590, "hg_38_start": 133256203, "new": "T", "original": "C", "rs_number": 56039827}]}, {"id": 1000065, "bgid": 1000065, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.28", "reference": false, "nt_mutation_list": [{"id": 562, "category": "del", "hgvs_name": "98+2T>C", "location": "Promoter", "location_info": "1", "hg_19_start": 136137500, "hg_38_start": 133262097, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000066, "bgid": 1000066, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.29", "reference": false, "nt_mutation_list": [{"id": 185, "category": "del", "hgvs_name": "311T>A", "location": "Intron", "location_info": "6", "hg_19_start": 136132858, "hg_38_start": 133257471, "new": "T", "original": "A", "rs_number": 782676228}]}, {"id": 1000067, "bgid": 1000067, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.30.01", "reference": false, "nt_mutation_list": [{"id": 324, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000068, "bgid": 1000068, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.30.02", "reference": false, "nt_mutation_list": [{"id": 372, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 325, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000069, "bgid": 1000069, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.31.01", "reference": false, "nt_mutation_list": [{"id": 505, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 433, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 373, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 326, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 143, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000084, "bgid": 1000084, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW31.02-05", "reference": false, "nt_mutation_list": [{"id": 507, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 434, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 374, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 327, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000070, "bgid": 1000070, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.32", "reference": false, "nt_mutation_list": [{"id": 563, "category": "del", "hgvs_name": "996G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131121, "hg_38_start": 133255734, "new": "T", "original": "C", "rs_number": 782621375}]}, {"id": 1000071, "bgid": 1000071, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.33", "reference": false, "nt_mutation_list": [{"id": 305, "category": "del", "hgvs_name": "543G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131574, "hg_38_start": 133256187, "new": "A", "original": "C", "rs_number": null}, {"id": 245, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000072, "bgid": 1000072, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.34", "reference": false, "nt_mutation_list": [{"id": 8, "category": "del", "hgvs_name": "1009A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131108, "hg_38_start": 133255721, "new": "C", "original": "T", "rs_number": 566015043}, {"id": 506, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 246, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000073, "bgid": 1000073, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.35", "reference": false, "nt_mutation_list": [{"id": 533, "category": "del", "hgvs_name": "860C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131257, "hg_38_start": 133255870, "new": "A", "original": "G", "rs_number": 782524570}, {"id": 247, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000074, "bgid": 1000074, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.36", "reference": false, "nt_mutation_list": [{"id": 317, "category": "del", "hgvs_name": "607G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131510, "hg_38_start": 133256123, "new": "T", "original": "C", "rs_number": 374698850}]}, {"id": 1000075, "bgid": 1000075, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.37", "reference": false, "nt_mutation_list": [{"id": 560, "category": "del", "hgvs_name": "940A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131177, "hg_38_start": 133255790, "new": "C", "original": "T", "rs_number": 1459364624}]}, {"id": 1000076, "bgid": 1000076, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.38", "reference": false, "nt_mutation_list": [{"id": 203, "category": "del", "hgvs_name": "426G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131691, "hg_38_start": 133256304, "new": "G", "original": "C", "rs_number": null}]}, {"id": 1000077, "bgid": 1000077, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.39", "reference": false, "nt_mutation_list": [{"id": 197, "category": "del", "hgvs_name": "385T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131732, "hg_38_start": 133256345, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000078, "bgid": 1000078, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.40", "reference": false, "nt_mutation_list": [{"id": 264, "category": "del", "hgvs_name": "499G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131618, "hg_38_start": 133256231, "new": "A", "original": "C", "rs_number": 782815917}]}, {"id": 1000079, "bgid": 1000079, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.41", "reference": false, "nt_mutation_list": [{"id": 193, "category": "del", "hgvs_name": "370A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132799, "hg_38_start": 133257412, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000080, "bgid": 1000080, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.42", "reference": false, "nt_mutation_list": [{"id": 542, "category": "del", "hgvs_name": "905A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131212, "hg_38_start": 133255825, "new": "C", "original": "T", "rs_number": null}, {"id": 248, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000081, "bgid": 1000081, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.43", "reference": false, "nt_mutation_list": [{"id": 418, "category": "del", "hgvs_name": "721C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131396, "hg_38_start": 133256009, "new": "A", "original": "G", "rs_number": 781957267}, {"id": 249, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000082, "bgid": 1000082, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.44", "reference": false, "nt_mutation_list": [{"id": 194, "category": "del", "hgvs_name": "374+4A>G", "location": "Promoter", "location_info": "6", "hg_19_start": 136131739, "hg_38_start": 133256352, "new": "C", "original": "T", "rs_number": 782069432}]}, {"id": 1000083, "bgid": 1000083, "allelecategory": "A", "gene": "ABO", "name": "ABO*AW.45", "reference": false, "nt_mutation_list": [{"id": 39, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 250, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 79, "category": "ins", "hgvs_name": "203+1delG", "location": "Promoter", "location_info": "4", "hg_19_start": 136135222, "hg_38_start": 133259818, "new": "A", "original": "AC", "rs_number": 782023144}]}, {"id": 1000085, "bgid": 1000085, "allelecategory": "B", "gene": "ABO", "name": "ABO*B.01", "reference": false, "nt_mutation_list": [{"id": 545, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 480, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 459, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 403, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 353, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 270, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 144, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000086, "bgid": 1000086, "allelecategory": "B", "gene": "ABO", "name": "ABO*B.02", "reference": false, "nt_mutation_list": [{"id": 540, "category": "del", "hgvs_name": "892G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131225, "hg_38_start": 133255838, "new": "A", "original": "C", "rs_number": 781948068}]}, {"id": 1000087, "bgid": 1000087, "allelecategory": "B", "gene": "ABO", "name": "ABO*B.03", "reference": false, "nt_mutation_list": [{"id": 310, "category": "del", "hgvs_name": "559C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131558, "hg_38_start": 133256171, "new": "A", "original": "G", "rs_number": 866584466}]}, {"id": 1000088, "bgid": 1000088, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.01", "reference": false, "nt_mutation_list": [{"id": 13, "category": "del", "hgvs_name": "1054C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131063, "hg_38_start": 133255676, "new": "A", "original": "G", "rs_number": 56390333}]}, {"id": 1000089, "bgid": 1000089, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.02", "reference": false, "nt_mutation_list": [{"id": 328, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000090, "bgid": 1000090, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.03", "reference": false, "nt_mutation_list": [{"id": 54, "category": "del", "hgvs_name": "155+5G>A", "location": "Promoter", "location_info": "3", "hg_19_start": 136136716, "hg_38_start": 133261313, "new": "T", "original": "C", "rs_number": 782187929}]}, {"id": 1000091, "bgid": 1000091, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.04", "reference": false, "nt_mutation_list": [{"id": 94, "category": "del", "hgvs_name": "247G>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132922, "hg_38_start": 133257535, "new": "A", "original": "C", "rs_number": null}]}, {"id": 1000092, "bgid": 1000092, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.05", "reference": false, "nt_mutation_list": [{"id": 202, "category": "del", "hgvs_name": "425T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131692, "hg_38_start": 133256305, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000093, "bgid": 1000093, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.06", "reference": false, "nt_mutation_list": [{"id": 306, "category": "del", "hgvs_name": "547G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131570, "hg_38_start": 133256183, "new": "T", "original": "C", "rs_number": null}]}, {"id": 1000094, "bgid": 1000094, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.07", "reference": false, "nt_mutation_list": [{"id": 200, "category": "del", "hgvs_name": "410C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131707, "hg_38_start": 133256320, "new": "A", "original": "G", "rs_number": 782080286}]}, {"id": 1000095, "bgid": 1000095, "allelecategory": "B", "gene": "ABO", "name": "ABO*B3.08", "reference": false, "nt_mutation_list": [{"id": 559, "category": "del", "hgvs_name": "938A>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131179, "hg_38_start": 133255792, "new": "G", "original": "T", "rs_number": null}]}, {"id": 1000987, "bgid": 1000987, "allelecategory": "B", "gene": "ABO", "name": "ABO*BEL.01", "reference": false, "nt_mutation_list": [{"id": 800, "category": "del", "hgvs_name": "641T>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131476, "hg_38_start": 133256089, "new": "C", "original": "A", "rs_number": 1285446079}]}, {"id": 1000988, "bgid": 1000988, "allelecategory": "B", "gene": "ABO", "name": "ABO*BEL.02", "reference": false, "nt_mutation_list": [{"id": 801, "category": "del", "hgvs_name": "669G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131448, "hg_38_start": 133256061, "new": "A", "original": "C", "rs_number": null}]}, {"id": 1000989, "bgid": 1000989, "allelecategory": "B", "gene": "ABO", "name": "ABO*BEL.03", "reference": false, "nt_mutation_list": [{"id": 802, "category": "del", "hgvs_name": "502C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131615, "hg_38_start": 133256228, "new": "A", "original": "G", "rs_number": 573234689}]}, {"id": 1000991, "bgid": 1000991, "allelecategory": "B", "gene": "ABO", "name": "ABO*BEL.04", "reference": false, "nt_mutation_list": [{"id": 810, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 809, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 808, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 807, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 806, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 805, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 804, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000990, "bgid": 1000990, "allelecategory": "B", "gene": "ABO", "name": "ABO*BEL.05", "reference": false, "nt_mutation_list": [{"id": 803, "category": "del", "hgvs_name": "952G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131165, "hg_38_start": 133255778, "new": "T", "original": "C", "rs_number": 781784520}]}, {"id": 1000102, "bgid": 1000102, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.01", "reference": false, "nt_mutation_list": [{"id": 538, "category": "del", "hgvs_name": "871G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131246, "hg_38_start": 133255859, "new": "T", "original": "C", "rs_number": 781789696}]}, {"id": 1000103, "bgid": 1000103, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.02", "reference": false, "nt_mutation_list": [{"id": 539, "category": "del", "hgvs_name": "873C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131244, "hg_38_start": 133255857, "new": "C", "original": "G", "rs_number": 782818660}]}, {"id": 1000104, "bgid": 1000104, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.03", "reference": false, "nt_mutation_list": [{"id": 419, "category": "del", "hgvs_name": "721C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131396, "hg_38_start": 133256009, "new": "A", "original": "G", "rs_number": 781957267}]}, {"id": 1000105, "bgid": 1000105, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.04", "reference": false, "nt_mutation_list": [{"id": 307, "category": "del", "hgvs_name": "548A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131569, "hg_38_start": 133256182, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000106, "bgid": 1000106, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.05", "reference": false, "nt_mutation_list": [{"id": 295, "category": "del", "hgvs_name": "539G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131578, "hg_38_start": 133256191, "new": "T", "original": "C", "rs_number": 781806838}]}, {"id": 1000107, "bgid": 1000107, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.06", "reference": false, "nt_mutation_list": [{"id": 9, "category": "del", "hgvs_name": "1036A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131081, "hg_38_start": 133255694, "new": "C", "original": "T", "rs_number": 1354627152}]}, {"id": 1000108, "bgid": 1000108, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.07", "reference": false, "nt_mutation_list": [{"id": 15, "category": "del", "hgvs_name": "1055G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131062, "hg_38_start": 133255675, "new": "T", "original": "C", "rs_number": 1019994127}]}, {"id": 1000109, "bgid": 1000109, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.08", "reference": false, "nt_mutation_list": [{"id": 534, "category": "del", "hgvs_name": "863T>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131254, "hg_38_start": 133255867, "new": "C", "original": "A", "rs_number": null}]}, {"id": 1000110, "bgid": 1000110, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.09", "reference": false, "nt_mutation_list": [{"id": 10, "category": "del", "hgvs_name": "1037A>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131080, "hg_38_start": 133255693, "new": "A", "original": "T", "rs_number": null}]}, {"id": 1000111, "bgid": 1000111, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.10", "reference": false, "nt_mutation_list": [{"id": 309, "category": "del", "hgvs_name": "556A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131561, "hg_38_start": 133256174, "new": "C", "original": "T", "rs_number": 782121240}]}, {"id": 1000112, "bgid": 1000112, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.11", "reference": false, "nt_mutation_list": [{"id": 398, "category": "del", "hgvs_name": "695T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131422, "hg_38_start": 133256035, "new": "G", "original": "A", "rs_number": 796755925}]}, {"id": 1000113, "bgid": 1000113, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.12", "reference": false, "nt_mutation_list": [{"id": 140, "category": "del", "hgvs_name": "278C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132891, "hg_38_start": 133257504, "new": "A", "original": "G", "rs_number": null}]}, {"id": 1000966, "bgid": 1000966, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.14", "reference": false, "nt_mutation_list": [{"id": 811, "category": "del", "hgvs_name": "523G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131594, "hg_38_start": 133256207, "new": "T", "original": "C", "rs_number": 555009598}]}, {"id": 1000967, "bgid": 1000967, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.15", "reference": false, "nt_mutation_list": [{"id": 812, "category": "del", "hgvs_name": "565A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131552, "hg_38_start": 133256165, "new": "C", "original": "T", "rs_number": 782058388}]}, {"id": 1000968, "bgid": 1000968, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.16", "reference": false, "nt_mutation_list": [{"id": 813, "category": "del", "hgvs_name": "575T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131542, "hg_38_start": 133256155, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000969, "bgid": 1000969, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.17", "reference": false, "nt_mutation_list": [{"id": 814, "category": "del", "hgvs_name": "784G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131333, "hg_38_start": 133255946, "new": "T", "original": "C", "rs_number": 1403489417}]}, {"id": 1000970, "bgid": 1000970, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.18", "reference": false, "nt_mutation_list": [{"id": 815, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}]}, {"id": 1000971, "bgid": 1000971, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.19", "reference": false, "nt_mutation_list": [{"id": 817, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 816, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000972, "bgid": 1000972, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.20", "reference": false, "nt_mutation_list": [{"id": 818, "category": "delins", "hgvs_name": "815_816insG", "location": "Intron", "location_info": "7", "hg_19_start": 136131301, "hg_38_start": 133255914, "new": "CC", "original": "C", "rs_number": 782558267}]}, {"id": 1000973, "bgid": 1000973, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.21", "reference": false, "nt_mutation_list": [{"id": 819, "category": "del", "hgvs_name": "688G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131429, "hg_38_start": 133256042, "new": "G", "original": "C", "rs_number": 1259797239}]}, {"id": 1000974, "bgid": 1000974, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.22", "reference": false, "nt_mutation_list": [{"id": 820, "category": "del", "hgvs_name": "503G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131614, "hg_38_start": 133256227, "new": "A", "original": "C", "rs_number": 1350454707}]}, {"id": 1000975, "bgid": 1000975, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.23", "reference": false, "nt_mutation_list": [{"id": 821, "category": "del", "hgvs_name": "743G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131374, "hg_38_start": 133255987, "new": "G", "original": "C", "rs_number": 543029446}]}, {"id": 1000976, "bgid": 1000976, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.24", "reference": false, "nt_mutation_list": [{"id": 822, "category": "del", "hgvs_name": "558G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131559, "hg_38_start": 133256172, "new": "A", "original": "C", "rs_number": 1377868774}]}, {"id": 1000977, "bgid": 1000977, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.25", "reference": false, "nt_mutation_list": [{"id": 824, "category": "del", "hgvs_name": "619C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131498, "hg_38_start": 133256111, "new": "C", "original": "G", "rs_number": 782526505}, {"id": 823, "category": "del", "hgvs_name": "103G>A", "location": "Intron", "location_info": "3", "hg_19_start": 136136773, "hg_38_start": 133261370, "new": "T", "original": "C", "rs_number": 8176696}]}, {"id": 1000978, "bgid": 1000978, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.26", "reference": false, "nt_mutation_list": [{"id": 825, "category": "del", "hgvs_name": "53G>T", "location": "Intron", "location_info": "2", "hg_19_start": 136137547, "hg_38_start": 133262144, "new": "A", "original": "C", "rs_number": 55876802}]}, {"id": 1000979, "bgid": 1000979, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.27", "reference": false, "nt_mutation_list": [{"id": 826, "category": "del", "hgvs_name": "905A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131212, "hg_38_start": 133255825, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000980, "bgid": 1000980, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.28", "reference": false, "nt_mutation_list": [{"id": 827, "category": "del", "hgvs_name": "541T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131576, "hg_38_start": 133256189, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000981, "bgid": 1000981, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.29", "reference": false, "nt_mutation_list": [{"id": 828, "category": "del", "hgvs_name": "588C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131529, "hg_38_start": 133256142, "new": "C", "original": "G", "rs_number": 1239647466}]}, {"id": 1000982, "bgid": 1000982, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.30", "reference": false, "nt_mutation_list": [{"id": 829, "category": "del", "hgvs_name": "976G>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131141, "hg_38_start": 133255754, "new": "A", "original": "C", "rs_number": null}]}, {"id": 1000983, "bgid": 1000983, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.31", "reference": false, "nt_mutation_list": [{"id": 830, "category": "del", "hgvs_name": "900G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131217, "hg_38_start": 133255830, "new": "G", "original": "C", "rs_number": null}]}, {"id": 1000984, "bgid": 1000984, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.32", "reference": false, "nt_mutation_list": [{"id": 831, "category": "del", "hgvs_name": "808T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131309, "hg_38_start": 133255922, "new": "T", "original": "A", "rs_number": null}]}, {"id": 1000985, "bgid": 1000985, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.33", "reference": false, "nt_mutation_list": [{"id": 832, "category": "del", "hgvs_name": "550G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131567, "hg_38_start": 133256180, "new": "T", "original": "C", "rs_number": 781897037}]}, {"id": 1000986, "bgid": 1000986, "allelecategory": "B", "gene": "ABO", "name": "ABO*BW.34", "reference": false, "nt_mutation_list": [{"id": 833, "category": "del", "hgvs_name": "889G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131228, "hg_38_start": 133255841, "new": "T", "original": "C", "rs_number": 370138477}]}, {"id": 1000096, "bgid": 1000096, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.01", "reference": false, "nt_mutation_list": [{"id": 546, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 481, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 460, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 271, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 145, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000097, "bgid": 1000097, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.02", "reference": false, "nt_mutation_list": [{"id": 547, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 482, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 461, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 404, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 400, "category": "del", "hgvs_name": "700C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131417, "hg_38_start": 133256030, "new": "C", "original": "G", "rs_number": 55722397}, {"id": 354, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 272, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 146, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000098, "bgid": 1000098, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.03", "reference": false, "nt_mutation_list": [{"id": 548, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 483, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 462, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 355, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 273, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 147, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000099, "bgid": 1000099, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.04", "reference": false, "nt_mutation_list": [{"id": 549, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 484, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 463, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 405, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 356, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 321, "category": "del", "hgvs_name": "640A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131477, "hg_38_start": 133256090, "new": "C", "original": "T", "rs_number": 964984014}, {"id": 274, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 148, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000100, "bgid": 1000100, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.05", "reference": false, "nt_mutation_list": [{"id": 550, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 485, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 464, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 406, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 357, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 322, "category": "del", "hgvs_name": "641T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131476, "hg_38_start": 133256089, "new": "G", "original": "A", "rs_number": 1285446079}, {"id": 275, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 149, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000101, "bgid": 1000101, "allelecategory": "B(A)", "gene": "ABO", "name": "ABO*BA.06", "reference": false, "nt_mutation_list": [{"id": 551, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 465, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 407, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 358, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 276, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 150, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000176, "bgid": 1000176, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.01", "reference": false, "nt_mutation_list": [{"id": 486, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 251, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000177, "bgid": 1000177, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.02", "reference": false, "nt_mutation_list": [{"id": 487, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 408, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 359, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 277, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}]}, {"id": 1000178, "bgid": 1000178, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.03", "reference": false, "nt_mutation_list": [{"id": 552, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 488, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 466, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 409, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 401, "category": "del", "hgvs_name": "700C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131417, "hg_38_start": 133256030, "new": "A", "original": "G", "rs_number": 55722397}, {"id": 360, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 278, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 151, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000179, "bgid": 1000179, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.04", "reference": false, "nt_mutation_list": [{"id": 467, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 252, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000180, "bgid": 1000180, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.05", "reference": false, "nt_mutation_list": [{"id": 553, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 468, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 410, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 361, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 279, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 152, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000181, "bgid": 1000181, "allelecategory": "cisAB", "gene": "ABO", "name": "ABO*cisAB.06", "reference": false, "nt_mutation_list": [{"id": 554, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 489, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 469, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 411, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 362, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 153, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000114, "bgid": 1000114, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.01", "reference": false, "nt_mutation_list": [{"id": 95, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000115, "bgid": 1000115, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.02", "reference": false, "nt_mutation_list": [{"id": 508, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 435, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 375, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 329, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 154, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 96, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 44, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 83, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 68, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 57, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000116, "bgid": 1000116, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.04", "reference": false, "nt_mutation_list": [{"id": 312, "category": "del", "hgvs_name": "579T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131538, "hg_38_start": 133256151, "new": "G", "original": "A", "rs_number": 55764262}, {"id": 97, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000117, "bgid": 1000117, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.05", "reference": false, "nt_mutation_list": [{"id": 155, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 98, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000118, "bgid": 1000118, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.06", "reference": false, "nt_mutation_list": [{"id": 509, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 436, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 376, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 330, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 99, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000119, "bgid": 1000119, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.07", "reference": false, "nt_mutation_list": [{"id": 510, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 437, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 420, "category": "del", "hgvs_name": "721C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131396, "hg_38_start": 133256009, "new": "A", "original": "G", "rs_number": 781957267}, {"id": 377, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 331, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 156, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 100, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000120, "bgid": 1000120, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.09", "reference": false, "nt_mutation_list": [{"id": 253, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 186, "category": "del", "hgvs_name": "318C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132851, "hg_38_start": 133257464, "new": "A", "original": "G", "rs_number": 8176721}, {"id": 101, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000121, "bgid": 1000121, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.10", "reference": false, "nt_mutation_list": [{"id": 363, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 102, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000122, "bgid": 1000122, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.11", "reference": false, "nt_mutation_list": [{"id": 511, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 438, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 378, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 332, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 302, "category": "del", "hgvs_name": "542G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131575, "hg_38_start": 133256188, "new": "T", "original": "C", "rs_number": 55727303}, {"id": 157, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 103, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000123, "bgid": 1000123, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.12", "reference": false, "nt_mutation_list": [{"id": 512, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 439, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 379, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 333, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 315, "category": "del", "hgvs_name": "595C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131522, "hg_38_start": 133256135, "new": "A", "original": "G", "rs_number": 8176739}, {"id": 158, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 104, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000124, "bgid": 1000124, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.13", "reference": false, "nt_mutation_list": [{"id": 513, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 440, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 380, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 334, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 159, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 105, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000125, "bgid": 1000125, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.22", "reference": false, "nt_mutation_list": [{"id": 40, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 254, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 106, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000126, "bgid": 1000126, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.23", "reference": false, "nt_mutation_list": [{"id": 14, "category": "del", "hgvs_name": "1054C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131063, "hg_38_start": 133255676, "new": "A", "original": "G", "rs_number": 56390333}, {"id": 514, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 441, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 335, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 160, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 107, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000127, "bgid": 1000127, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.24", "reference": false, "nt_mutation_list": [{"id": 555, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 490, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 470, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 412, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 364, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 280, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 161, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 108, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 45, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 69, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 58, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000128, "bgid": 1000128, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.25", "reference": false, "nt_mutation_list": [{"id": 206, "category": "del", "hgvs_name": "454T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131663, "hg_38_start": 133256276, "new": "G", "original": "A", "rs_number": 563480845}, {"id": 109, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000129, "bgid": 1000129, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.26", "reference": false, "nt_mutation_list": [{"id": 430, "category": "del", "hgvs_name": "768C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131349, "hg_38_start": 133255962, "new": "T", "original": "G", "rs_number": 8176744}, {"id": 110, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000130, "bgid": 1000130, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.27", "reference": false, "nt_mutation_list": [{"id": 423, "category": "del", "hgvs_name": "729C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131388, "hg_38_start": 133256001, "new": "A", "original": "G", "rs_number": 35494115}, {"id": 255, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 187, "category": "del", "hgvs_name": "318C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132851, "hg_38_start": 133257464, "new": "A", "original": "G", "rs_number": 8176721}, {"id": 111, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000131, "bgid": 1000131, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.28", "reference": false, "nt_mutation_list": [{"id": 543, "category": "del", "hgvs_name": "926A>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131191, "hg_38_start": 133255804, "new": "C", "original": "T", "rs_number": 56346931}, {"id": 112, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000132, "bgid": 1000132, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.29", "reference": false, "nt_mutation_list": [{"id": 188, "category": "del", "hgvs_name": "318C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132851, "hg_38_start": 133257464, "new": "A", "original": "G", "rs_number": 8176721}, {"id": 113, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000133, "bgid": 1000133, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.31", "reference": false, "nt_mutation_list": [{"id": 515, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 442, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 381, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 336, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 292, "category": "del", "hgvs_name": "529G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131588, "hg_38_start": 133256201, "new": "T", "original": "C", "rs_number": 55687199}, {"id": 162, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 114, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000134, "bgid": 1000134, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.32", "reference": false, "nt_mutation_list": [{"id": 516, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 443, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 382, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 337, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 293, "category": "del", "hgvs_name": "538C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131579, "hg_38_start": 133256192, "new": "A", "original": "G", "rs_number": 1021634223}, {"id": 163, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 115, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000135, "bgid": 1000135, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.33", "reference": false, "nt_mutation_list": [{"id": 517, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 444, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 383, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 338, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 263, "category": "del", "hgvs_name": "498C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131619, "hg_38_start": 133256232, "new": "A", "original": "G", "rs_number": 781927531}, {"id": 164, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 116, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000136, "bgid": 1000136, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.34", "reference": false, "nt_mutation_list": [{"id": 518, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 445, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 384, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 339, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 192, "category": "del", "hgvs_name": "351G>A", "location": "Intron", "location_info": "6", "hg_19_start": 136132818, "hg_38_start": 133257431, "new": "T", "original": "C", "rs_number": 1404871416}, {"id": 165, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 117, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000137, "bgid": 1000137, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.35", "reference": false, "nt_mutation_list": [{"id": 519, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 446, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 385, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 166, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 118, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 46, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 84, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 70, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 59, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000138, "bgid": 1000138, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.36", "reference": false, "nt_mutation_list": [{"id": 520, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 386, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 340, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 167, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 119, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 47, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 85, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 71, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 60, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000139, "bgid": 1000139, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.39", "reference": false, "nt_mutation_list": [{"id": 521, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 447, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 387, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 168, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 120, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 86, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000140, "bgid": 1000140, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.40", "reference": false, "nt_mutation_list": [{"id": 522, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 388, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 341, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 169, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 121, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 48, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 72, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 61, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000141, "bgid": 1000141, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.41", "reference": false, "nt_mutation_list": [{"id": 556, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 491, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 471, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 413, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 365, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 281, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 170, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 122, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000142, "bgid": 1000142, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.44", "reference": false, "nt_mutation_list": [{"id": 523, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 448, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 342, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 171, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 123, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000143, "bgid": 1000143, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.45", "reference": false, "nt_mutation_list": [{"id": 449, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 343, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 124, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000144, "bgid": 1000144, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.46", "reference": false, "nt_mutation_list": [{"id": 524, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 450, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 344, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 125, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000145, "bgid": 1000145, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.56", "reference": false, "nt_mutation_list": [{"id": 262, "category": "ins", "hgvs_name": "496delA", "location": "Intron", "location_info": "7", "hg_19_start": 136131621, "hg_38_start": 133256234, "new": "G", "original": "GT", "rs_number": 563704490}, {"id": 126, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000146, "bgid": 1000146, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.57", "reference": false, "nt_mutation_list": [{"id": 475, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 127, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000147, "bgid": 1000147, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.58", "reference": false, "nt_mutation_list": [{"id": 525, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 6, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 395, "category": "del", "hgvs_name": "687C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131430, "hg_38_start": 133256043, "new": "A", "original": "G", "rs_number": 56215404}, {"id": 389, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 345, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 172, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 128, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000148, "bgid": 1000148, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.61", "reference": false, "nt_mutation_list": [{"id": 426, "category": "del", "hgvs_name": "743G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131374, "hg_38_start": 133255987, "new": "G", "original": "C", "rs_number": 543029446}, {"id": 129, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000149, "bgid": 1000149, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.67", "reference": false, "nt_mutation_list": [{"id": 526, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 451, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 390, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 346, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 173, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 130, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 49, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 11, "category": "del", "hgvs_name": "103G>A", "location": "Intron", "location_info": "3", "hg_19_start": 136136773, "hg_38_start": 133261370, "new": "T", "original": "C", "rs_number": 8176696}, {"id": 87, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 73, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 62, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000150, "bgid": 1000150, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.68", "reference": false, "nt_mutation_list": [{"id": 527, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 452, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 391, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 347, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 174, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 131, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 50, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 74, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 63, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000151, "bgid": 1000151, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.71", "reference": false, "nt_mutation_list": [{"id": 528, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 132, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000152, "bgid": 1000152, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.75", "reference": false, "nt_mutation_list": [{"id": 529, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 453, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 392, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 348, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 303, "category": "del", "hgvs_name": "542G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131575, "hg_38_start": 133256188, "new": "T", "original": "C", "rs_number": 55727303}, {"id": 175, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 133, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 51, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 88, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}, {"id": 75, "category": "del", "hgvs_name": "189C>T", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259833, "new": "G", "original": "A", "rs_number": null}, {"id": 64, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000153, "bgid": 1000153, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.76", "reference": false, "nt_mutation_list": [{"id": 12, "category": "ins", "hgvs_name": "1046_1048delAGG", "location": "Intron", "location_info": "7", "hg_19_start": 136131069, "hg_38_start": 133255682, "new": "G", "original": "GCCT", "rs_number": null}, {"id": 313, "category": "del", "hgvs_name": "579T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131538, "hg_38_start": 133256151, "new": "G", "original": "A", "rs_number": 55764262}, {"id": 134, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}]}, {"id": 1000154, "bgid": 1000154, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.82", "reference": false, "nt_mutation_list": [{"id": 135, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 77, "category": "del", "hgvs_name": "190G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259832, "new": "T", "original": "C", "rs_number": 56335272}]}, {"id": 1000155, "bgid": 1000155, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.01.83", "reference": false, "nt_mutation_list": [{"id": 176, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 136, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 52, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 65, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}, {"id": 1000156, "bgid": 1000156, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.02.01", "reference": false, "nt_mutation_list": [{"id": 476, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 282, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 177, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 298, "category": "del", "hgvs_name": "53G>T", "location": "Intron", "location_info": "2", "hg_19_start": 136137547, "hg_38_start": 133262144, "new": "A", "original": "C", "rs_number": 55876802}, {"id": 89, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000157, "bgid": 1000157, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.02.02", "reference": false, "nt_mutation_list": [{"id": 477, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 396, "category": "del", "hgvs_name": "689G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131428, "hg_38_start": 133256041, "new": "T", "original": "C", "rs_number": 56116432}, {"id": 351, "category": "del", "hgvs_name": "649C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131468, "hg_38_start": 133256081, "new": "A", "original": "G", "rs_number": 56408700}, {"id": 283, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 178, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 299, "category": "del", "hgvs_name": "53G>T", "location": "Intron", "location_info": "2", "hg_19_start": 136137547, "hg_38_start": 133262144, "new": "A", "original": "C", "rs_number": 55876802}, {"id": 90, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000158, "bgid": 1000158, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.02.03", "reference": false, "nt_mutation_list": [{"id": 478, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 397, "category": "del", "hgvs_name": "689G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131428, "hg_38_start": 133256041, "new": "T", "original": "C", "rs_number": 56116432}, {"id": 284, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 179, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 300, "category": "del", "hgvs_name": "53G>T", "location": "Intron", "location_info": "2", "hg_19_start": 136137547, "hg_38_start": 133262144, "new": "A", "original": "C", "rs_number": 55876802}, {"id": 91, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000159, "bgid": 1000159, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.02.04", "reference": false, "nt_mutation_list": [{"id": 479, "category": "del", "hgvs_name": "802G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131315, "hg_38_start": 133255928, "new": "T", "original": "C", "rs_number": 41302905}, {"id": 285, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 261, "category": "del", "hgvs_name": "488C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131629, "hg_38_start": 133256242, "new": "A", "original": "G", "rs_number": 55756402}, {"id": 180, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}, {"id": 301, "category": "del", "hgvs_name": "53G>T", "location": "Intron", "location_info": "2", "hg_19_start": 136137547, "hg_38_start": 133262144, "new": "A", "original": "C", "rs_number": 55876802}, {"id": 92, "category": "del", "hgvs_name": "220C>T", "location": "Intron", "location_info": "5", "hg_19_start": null, "hg_38_start": 133258116, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000160, "bgid": 1000160, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.03", "reference": false, "nt_mutation_list": [{"id": 41, "category": "ins", "hgvs_name": "1061delC", "location": "Intron", "location_info": "7", "hg_19_start": 136131056, "hg_38_start": 133255669, "new": "C", "original": "CG", "rs_number": 56392308}, {"id": 497, "category": "delins", "hgvs_name": "804dupG", "location": "Intron", "location_info": "7", "hg_19_start": 136131313, "hg_38_start": 133255926, "new": "AC", "original": "A", "rs_number": null}, {"id": 256, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000161, "bgid": 1000161, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.04.01", "reference": false, "nt_mutation_list": [{"id": 535, "category": "delins", "hgvs_name": "87_88insG", "location": "Intron", "location_info": "2", "hg_19_start": 136137512, "hg_38_start": 133262109, "new": "CC", "original": "C", "rs_number": null}]}, {"id": 1000162, "bgid": 1000162, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.04.02", "reference": false, "nt_mutation_list": [{"id": 257, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}, {"id": 137, "category": "ins", "hgvs_name": "261delG", "location": "Intron", "location_info": "6", "hg_19_start": 136132908, "hg_38_start": 133257521, "new": "TC", "original": "T", "rs_number": 8176719}, {"id": 536, "category": "delins", "hgvs_name": "87_88insG", "location": "Intron", "location_info": "2", "hg_19_start": 136137512, "hg_38_start": 133262109, "new": "CC", "original": "C", "rs_number": null}]}, {"id": 1000163, "bgid": 1000163, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.05", "reference": false, "nt_mutation_list": [{"id": 189, "category": "del", "hgvs_name": "322C>T", "location": "Intron", "location_info": "6", "hg_19_start": 136132847, "hg_38_start": 133257460, "new": "A", "original": "G", "rs_number": 77805226}]}, {"id": 1000164, "bgid": 1000164, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.06", "reference": false, "nt_mutation_list": [{"id": 304, "category": "del", "hgvs_name": "542G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131575, "hg_38_start": 133256188, "new": "T", "original": "C", "rs_number": 55727303}]}, {"id": 1000165, "bgid": 1000165, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.07", "reference": false, "nt_mutation_list": [{"id": 541, "category": "del", "hgvs_name": "893C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131224, "hg_38_start": 133255837, "new": "A", "original": "G", "rs_number": null}, {"id": 258, "category": "del", "hgvs_name": "467C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131650, "hg_38_start": 133256263, "new": "A", "original": "G", "rs_number": 1053878}]}, {"id": 1000166, "bgid": 1000166, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.08", "reference": false, "nt_mutation_list": [{"id": 544, "category": "del", "hgvs_name": "927C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131190, "hg_38_start": 133255803, "new": "T", "original": "G", "rs_number": 782586438}]}, {"id": 1000167, "bgid": 1000167, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.09.01", "reference": false, "nt_mutation_list": [{"id": 530, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 454, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 393, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 349, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}]}, {"id": 1000168, "bgid": 1000168, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.09.02", "reference": false, "nt_mutation_list": [{"id": 531, "category": "del", "hgvs_name": "829G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131288, "hg_38_start": 133255901, "new": "T", "original": "C", "rs_number": 8176748}, {"id": 455, "category": "del", "hgvs_name": "771C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131346, "hg_38_start": 133255959, "new": "A", "original": "G", "rs_number": 8176745}, {"id": 394, "category": "del", "hgvs_name": "681G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131436, "hg_38_start": 133256049, "new": "T", "original": "C", "rs_number": 8176742}, {"id": 350, "category": "del", "hgvs_name": "646T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131471, "hg_38_start": 133256084, "new": "T", "original": "A", "rs_number": 8176740}, {"id": 181, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000169, "bgid": 1000169, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.10", "reference": false, "nt_mutation_list": [{"id": 368, "category": "delins", "hgvs_name": "66_67insG", "location": "Intron", "location_info": "2", "hg_19_start": 136137533, "hg_38_start": 133262130, "new": "AC", "original": "A", "rs_number": null}]}, {"id": 1000170, "bgid": 1000170, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.11", "reference": false, "nt_mutation_list": [{"id": 557, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 492, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 472, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 414, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 366, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 286, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 266, "category": "ins", "hgvs_name": "505_507delCAG", "location": "Intron", "location_info": "7", "hg_19_start": 136131610, "hg_38_start": 133256223, "new": "G", "original": "GCTG", "rs_number": null}, {"id": 182, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000171, "bgid": 1000171, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.12", "reference": false, "nt_mutation_list": [{"id": 558, "category": "del", "hgvs_name": "930G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131187, "hg_38_start": 133255800, "new": "T", "original": "C", "rs_number": 8176749}, {"id": 493, "category": "del", "hgvs_name": "803G>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131314, "hg_38_start": 133255927, "new": "G", "original": "C", "rs_number": 8176747}, {"id": 473, "category": "del", "hgvs_name": "796C>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131321, "hg_38_start": 133255934, "new": "T", "original": "G", "rs_number": 8176746}, {"id": 415, "category": "del", "hgvs_name": "703G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131414, "hg_38_start": 133256027, "new": "T", "original": "C", "rs_number": 8176743}, {"id": 367, "category": "del", "hgvs_name": "657C>T", "location": "Intron", "location_info": "7", "hg_19_start": 136131460, "hg_38_start": 133256073, "new": "A", "original": "G", "rs_number": 8176741}, {"id": 311, "category": "del", "hgvs_name": "563G>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131554, "hg_38_start": 133256167, "new": "T", "original": "C", "rs_number": 782738668}, {"id": 287, "category": "del", "hgvs_name": "526C>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131591, "hg_38_start": 133256204, "new": "C", "original": "G", "rs_number": 7853989}, {"id": 183, "category": "del", "hgvs_name": "297A>G", "location": "Intron", "location_info": "6", "hg_19_start": 136132872, "hg_38_start": 133257485, "new": "C", "original": "T", "rs_number": 8176720}]}, {"id": 1000172, "bgid": 1000172, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.13", "reference": false, "nt_mutation_list": [{"id": 205, "category": "del", "hgvs_name": "452T>G", "location": "Intron", "location_info": "7", "hg_19_start": 136131665, "hg_38_start": 133256278, "new": "C", "original": "A", "rs_number": 1362045270}]}, {"id": 1000173, "bgid": 1000173, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.14", "reference": false, "nt_mutation_list": [{"id": 320, "category": "del", "hgvs_name": "635T>A", "location": "Intron", "location_info": "7", "hg_19_start": 136131482, "hg_38_start": 133256095, "new": "T", "original": "A", "rs_number": 782776943}]}, {"id": 1000174, "bgid": 1000174, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.15", "reference": false, "nt_mutation_list": [{"id": 458, "category": "del", "hgvs_name": "793T>C", "location": "Intron", "location_info": "7", "hg_19_start": 136131324, "hg_38_start": 133255937, "new": "G", "original": "A", "rs_number": null}]}, {"id": 1000175, "bgid": 1000175, "allelecategory": "O", "gene": "ABO", "name": "ABO*O.16", "reference": false, "nt_mutation_list": [{"id": 53, "category": "del", "hgvs_name": "106G>T", "location": "Intron", "location_info": "3", "hg_19_start": 136136770, "hg_38_start": 133261367, "new": "C", "original": "A", "rs_number": null}, {"id": 66, "category": "del", "hgvs_name": "188G>A", "location": "Intron", "location_info": "4", "hg_19_start": null, "hg_38_start": 133259834, "new": "C", "original": "T", "rs_number": null}]}]}}